View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_low_11 (Length: 368)
Name: NF12050_low_11
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 28539072 - 28539176
Alignment:
| Q |
19 |
tcatgagtggccttggaatctaaaggattgtctcgtgaggtagttttggttctaggggagatttttagagggtgggggtcgttttggtccttgccatgtc |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28539072 |
tcatgagtggcgttggaatctaaaggattgtctcgtgaggtagttttggttctaggagagatttttagagggtgggggtcgttttggtccttgtcatgtc |
28539171 |
T |
 |
| Q |
119 |
tcttg |
123 |
Q |
| |
|
||||| |
|
|
| T |
28539172 |
tcttg |
28539176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University