View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_low_27 (Length: 235)
Name: NF12050_low_27
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 3679169 - 3678966
Alignment:
| Q |
14 |
agatgaaatattaaatgaatgaaataaatttacaatattgaaaggagaaaaatatactaaatgagacgcattgtcactataggaagaaagaaatatttca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3679169 |
agatgaaatattaaatgaatgaaataaatttacaatattgaaaggagaaaaatatactaaatgagacgcattgtgactatagga-gaaagaaatatttca |
3679071 |
T |
 |
| Q |
114 |
actttcctcattctagaatatatgagacgcattgtcactatggtttatgaatgaatcaaagttacaataatatcttaagtgtgtatttagttagttaatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3679070 |
actttcctcattctagaatatatgagacgcattgtcactatggtttatgaatgaatcaaagttacaataatatcttaagtgtgtatttagttagttaatt |
3678971 |
T |
 |
| Q |
214 |
gtaca |
218 |
Q |
| |
|
||||| |
|
|
| T |
3678970 |
gtaca |
3678966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University