View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_low_28 (Length: 234)
Name: NF12050_low_28
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 36986362 - 36986540
Alignment:
| Q |
17 |
cagaaagagcaatgggtgaagaaaccttgatatcattatgaagattatgtttttgtagtgatctgtaaatgtttttcatggcggggacgagggacttcgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||| |
|
|
| T |
36986362 |
cagaaagagcaatgggtgaagaaaccttgatatcattatgaagattatgtttttgtagtgatctgtaaatgtttttcatggcgggtacgaggtatttcgt |
36986461 |
T |
|
| Q |
117 |
tgagttgtttgggtggacaaaaacttcattttcaacagcaaaggcttccataatagcgttttgttggttagcaacgatg |
195 |
Q |
| |
|
|||||||||||| | ||||||||||||||| ||||||||| |||||| ||||| | |||| |||||| |||||||||| |
|
|
| T |
36986462 |
tgagttgtttggatcaacaaaaacttcatttccaacagcaatggcttctataatggtgtttggttggtaagcaacgatg |
36986540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University