View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_low_30 (Length: 229)
Name: NF12050_low_30
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_low_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 2744559 - 2744782
Alignment:
| Q |
6 |
attttgaagatgatggactttggactttgggattttgtgtatcagctggttctgctgccctagcattggttttgtttctttgtggcacatcaaaatatag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744559 |
attttgaagatgatggactttggactttgggattttgtgtctcagctggttctgctgccctagcattggttttgtttctttgtggcacatcaaaatatag |
2744658 |
T |
|
| Q |
106 |
atactttaaacctgctggaaaccctcttcctaggttttgtcaagtttttgttgcagcaataagaaaatggaaggtccaaatgttcgacggtgaagataaa |
205 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744659 |
atactttaaacctgttggaaaccctcttcctaggttttgtcaagtttttgttgcagcaataagaaaatggaaggtccaaatgttcgacggtgaagataaa |
2744758 |
T |
|
| Q |
206 |
ctttatgaggttgaagattgttta |
229 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
2744759 |
cttcatgaggttgaagattgttta |
2744782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University