View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12051_high_26 (Length: 253)
Name: NF12051_high_26
Description: NF12051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12051_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 41277609 - 41277848
Alignment:
| Q |
5 |
ccctcattggtccaagcatccatacaaataggacaaatgagtccatcaatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277609 |
ccctcattggtccaagcatccatacaaataggacaaatgagtccatcaatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcg |
41277708 |
T |
 |
| Q |
105 |
gaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttgtttatctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctaga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277709 |
gaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttgtttctctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctaga |
41277808 |
T |
 |
| Q |
205 |
cgacggcacatcgggaacatattcttcatcgtcttcatct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277809 |
cgacggcacatcgggaacatattcttcatcgtcttcatct |
41277848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University