View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12051_high_27 (Length: 242)
Name: NF12051_high_27
Description: NF12051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12051_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 43322618 - 43322393
Alignment:
| Q |
1 |
ttgcttctgacaaaacacatgatgagatgttaaacaaaacacatgatatacaataaaactagtgaagaaaacagagtaagggacagaccaaacgagaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322618 |
ttgcttctgacaaaacacatgatgagatgttaaacaaaacacatgatatacaataaaactagtgaagaaaacagagtaagggacagaccaaacgagaata |
43322519 |
T |
|
| Q |
101 |
tttggtggtagtttacggtcttagtgtaccgttgtcggcaaaaccaaccccacgcacgggcaaatgccttgacgatcaaaagtggttaattcccaat--c |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
43322518 |
tttggtggtagtttacggtcttagtgtaccgttgtcggcaaaaccaaccccacgcacgggcaaatgccttgacgatcaaaagtggttaattcctaatggc |
43322419 |
T |
|
| Q |
199 |
accgg-aggctgaaatgggaccacta |
223 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
43322418 |
accggaaggctgaaatgggaccacta |
43322393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University