View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12051_high_30 (Length: 240)
Name: NF12051_high_30
Description: NF12051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12051_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 29 - 224
Target Start/End: Complemental strand, 1021002 - 1020808
Alignment:
| Q |
29 |
gggtgtcaatggagatggtgattggggtagattgggacactctacttgaattaaatttaggacatggctattatactttgtcaatacattgttttctttt |
128 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1021002 |
gggtgtcaatggagatggtgatttgggtagattgggacactctacttgaattaaatttaggacatggctattatactttgtcaatacgttgttttttttt |
1020903 |
T |
|
| Q |
129 |
aagtgtacaannnnnnnnnncatggaaatttagataaaaggtgacaatataagtgctactgcattgaatcaaactaaggtgagtatacaataaact |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1020902 |
aagtgtacaa-tttttttttcatggaaatttagataaaaggtgacaatataagtgctactgcattgaatcaaactaaggcgagtatacaataaact |
1020808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University