View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12051_low_29 (Length: 274)
Name: NF12051_low_29
Description: NF12051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12051_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 21 - 147
Target Start/End: Original strand, 41277367 - 41277493
Alignment:
| Q |
21 |
ttttttctgttgaagccattttctgacgcatgacatgccataaatgtgtccacaaggaagacaactaaaatcattcatcccnnnnnnncatagtaaatca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41277367 |
ttttttctgttgaagccattttctgacgcatgacatgccataaatgtgtccacaaggaagacaactaaaatcattcatcccaaaaaaacatagtaaatca |
41277466 |
T |
|
| Q |
121 |
actacaatttaacagtgtgagaatatc |
147 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
41277467 |
accacaatttaacagtgtgagaatatc |
41277493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 219 - 258
Target Start/End: Original strand, 41277565 - 41277604
Alignment:
| Q |
219 |
gttgcagaattagggtttagcggtgttaccaaatgtgatg |
258 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41277565 |
gttgcagaattagggtttagcagtgttaccaaatgtgatg |
41277604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University