View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12051_low_36 (Length: 233)
Name: NF12051_low_36
Description: NF12051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12051_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 37901628 - 37901827
Alignment:
| Q |
15 |
caaaggatgataaggatgttaaccaattaggttttggttttggtgacacaaggcctaagaaggggaaattattggtgaatatgattgtggcaagcttgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37901628 |
caaaggatgataaggatgttaaccaattaggtt------ttggtgacacaaggcctaagaaggggaagttattggtgaatatgattgtggcaagcttgtt |
37901721 |
T |
 |
| Q |
115 |
ggttttggtgcttggggtgtatgtcaaaaatgcattgtggtcatctcaaggagaatcaaaggaattttaatctaatatgcatattcattattgtaaatgc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37901722 |
ggttttggtgcttggggtgtatgtcaaaaatgcattgtggtcatctcaaggagaatcaaaggaattttaatctcatatgcatattcattattgtaaatgc |
37901821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University