View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12052_high_12 (Length: 281)
Name: NF12052_high_12
Description: NF12052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12052_high_12 |
 |  |
|
| [»] scaffold0768 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0768 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: scaffold0768
Description:
Target: scaffold0768; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 167 - 262
Target Start/End: Complemental strand, 384 - 289
Alignment:
| Q |
167 |
tatgtttgtccttttgctgcaagtgctgagaattgattgtattatacctataaaataagttttcatccactccatagacacatagccacacattgt |
262 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384 |
tatgtttgtccttttgttgcaagtgctgagaattgattgtattatacctataaaataagttttcatccactccatagacacatagccacacattgt |
289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0768; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 16 - 159
Target Start/End: Complemental strand, 604 - 460
Alignment:
| Q |
16 |
atgaaatccaatgacaaaatttgtttaaatgtgacaaaaacatcgttttatgtgctttatnnnnnnnnt-ataatacttttgttttattcattttcattg |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
604 |
atgaaatccaatgacaaaatttgttaaaatgtgacaaaaacattgttttgtgtgctttataaaaaaaattataatacttttgtttcattcattttcattg |
505 |
T |
 |
| Q |
115 |
tatctattgcaacacaaaaaataaaatcgaaataaagaaagttca |
159 |
Q |
| |
|
|||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
504 |
tatctattgcaacacacaaaaaaaattcgaaataaagaaagttca |
460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University