View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12052_low_14 (Length: 246)
Name: NF12052_low_14
Description: NF12052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12052_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 980828 - 981046
Alignment:
| Q |
18 |
ttctgcatatttagttgaataggttctgtctttccttaaccaagttgtcactataacctcagctcgacaaatgggtcttctcaaatctgtctcctatcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
980828 |
ttctgcatatttagttgaataggttccgtctttcttcaaccaagttgtcactataacctcagctcgacaaatgggtcttctcaattctgtctcctatcat |
980927 |
T |
 |
| Q |
118 |
attatgttaaagcaaagaaaaagttatagtatggtaggtaacctgaaactaaatttgcaaaaatacaaccaaaatatgattct-cacattagaacaaacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||| | |||||| |||| |||| |
|
|
| T |
980928 |
attatgttaaagcaaagaaaaagttagagtatgataggtaacctgaaactaaatttgcaaaaatactaccaaaatatgattttacacattggaac-aacc |
981026 |
T |
 |
| Q |
217 |
atttcgtacgccctcctttg |
236 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
981027 |
atttcgtatgccctcctttg |
981046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University