View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12053_high_7 (Length: 241)
Name: NF12053_high_7
Description: NF12053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12053_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 3681079 - 3681229
Alignment:
| Q |
1 |
caaaatctcacaattatgttgcttgtcgatgccttgattaccactagtaggtcaattttagattttagaacaagagtgaatttgctagcaccttatatct |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3681079 |
caaaatctcacagatatgttgcttgtcgatgctttgattaccactagtaggtcaattttagattttagaacaagagtgaatttgctagcaccttatatct |
3681178 |
T |
 |
| Q |
101 |
ctttgatgaattcaataatttagttcatatgaattagtaagatgattcaat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3681179 |
ctttgatgaattcaataatttagttcatatgaattagtaagatgatccaat |
3681229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University