View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12053_low_7 (Length: 277)
Name: NF12053_low_7
Description: NF12053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12053_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 17291612 - 17291368
Alignment:
| Q |
1 |
cgaggaaatcaacgttgaagatgaaactgaaagaaaagctctaactcaga--attgagatagaagattcattgataacctgtatgaatgagttattacac |
98 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17291612 |
cgaggaaatcaacgatgaagatgaaactgaaagaaaagctctaactcagagaattgagatagaagattcattgataacctgtatgaatgagttattacac |
17291513 |
T |
 |
| Q |
99 |
atgcttgtccttatatacttgcggagaaacaatcacaaattgagaaggattaaaatactagctaactaattcggtctcctcactaactgattctgttaca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17291512 |
atgcttgtccttatatacttgcggagaaacaatcacaaattaagagggattaaaatactagctaactaattcggtttcctcactaactgattctgttaca |
17291413 |
T |
 |
| Q |
199 |
tcactaactaggtcccatctaattgtgatgagttcgaatgttgag |
243 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
17291412 |
tcactaactaggtcccatctaatcgtgatgagttgaaatgttgag |
17291368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University