View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12053_low_8 (Length: 241)

Name: NF12053_low_8
Description: NF12053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12053_low_8
NF12053_low_8
[»] chr6 (1 HSPs)
chr6 (1-151)||(3681079-3681229)


Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 3681079 - 3681229
Alignment:
1 caaaatctcacaattatgttgcttgtcgatgccttgattaccactagtaggtcaattttagattttagaacaagagtgaatttgctagcaccttatatct 100  Q
    ||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3681079 caaaatctcacagatatgttgcttgtcgatgctttgattaccactagtaggtcaattttagattttagaacaagagtgaatttgctagcaccttatatct 3681178  T
101 ctttgatgaattcaataatttagttcatatgaattagtaagatgattcaat 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||    
3681179 ctttgatgaattcaataatttagttcatatgaattagtaagatgatccaat 3681229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University