View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12054_high_13 (Length: 203)
Name: NF12054_high_13
Description: NF12054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12054_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 24859827 - 24859643
Alignment:
| Q |
1 |
atgcaagaaataaaatgagaatcatgaaatatttatataaaatttggtttattgttcaagagaattggtgaatcatatagtacattatgatgcttgttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24859827 |
atgcaagaaataaaatgagaatcatgaaatatttatataaagtttggcttattgttcaagagaattggtgaattatatagtacattatgatgcttgttta |
24859728 |
T |
|
| Q |
101 |
aggttatcaccgcgtcaaagatcaagtatttatatgaaagaggtctttcatgactaacttgttcttttcaagcttaaatatgtca |
185 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
24859727 |
aggttatcaccgcatcaaagatccactatttatatgaaggaggtctttcatgactaacttgttcttttcaggtttaaatatgtca |
24859643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 23631884 - 23631838
Alignment:
| Q |
8 |
aaataaaatgagaatcatgaaatatttatataaaatttggtttattg |
54 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||| |
|
|
| T |
23631884 |
aaataaaatgagaatcatgaattacttatataaactttggtttattg |
23631838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 18900349 - 18900288
Alignment:
| Q |
8 |
aaataaaatgagaatcatgaaatatttatataaaatttggtttattgttcaagagaattggt |
69 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | ||||| ||| | |||||||| |||||| |
|
|
| T |
18900349 |
aaataaaatgagaatgataaaatatttatatacagtttggcttaatattcaagagtattggt |
18900288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 18785815 - 18785751
Alignment:
| Q |
8 |
aaataaaatgagaatcatgaaatatttatataaaatttggtttattgttcaagagaattggtgaa |
72 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18785815 |
aaataaaatgataatcataaaatatttatataaagtttgacttattgttcaagagaattggtgaa |
18785751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 79 - 168
Target Start/End: Complemental strand, 18785703 - 18785614
Alignment:
| Q |
79 |
agtacattatgatgcttgtttaaggttatcaccgcgtcaaagatcaagtatttatatgaaagaggtctttcatgactaacttgttctttt |
168 |
Q |
| |
|
|||||||||| || ||| |||| | ||||||||| | ||||||| | ||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
18785703 |
agtacattatcatacttaattaacgctatcaccgcattaaagatccaatatttctatgaaggaagtctttcatgactaacttgttctttt |
18785614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University