View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12054_low_13 (Length: 225)
Name: NF12054_low_13
Description: NF12054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12054_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 24860270 - 24860062
Alignment:
| Q |
1 |
tgagatttgagttatgctgtgtgtttgtgttgtgttgaataaatggaaggagaggtatatttatagagtg-ggggtgtaagaagagtgaagcgcgggatt |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | || ||||| |||||| ||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
24860270 |
tgagatttgagttatgctatgtgtttgtgttgtgttgagtgaagggaagaagaggtgtatttatagagtgtggggtgtaagaagagtgaggcgcgggatt |
24860171 |
T |
 |
| Q |
100 |
tgaaatgtgttttgaaaattttggttttgttgagatttgattgattgtggagtgagtgtggccgttgataagaagctaatcaacggttgtggtggttagt |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24860170 |
tgaaatgtgttttgaaatttttggttttgttgagatttgattgattgtggagtgaatgtggccgttgataagaagctaatcaacggttgtagtggttagt |
24860071 |
T |
 |
| Q |
200 |
tgagtgatg |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
24860070 |
tgagtgatg |
24860062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University