View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_high_33 (Length: 346)
Name: NF12055_high_33
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 43996287 - 43995960
Alignment:
| Q |
1 |
tcaactcatacgaaaaattgcaattatcttcatcatcttgcaaaataaatcaataacgagnnnnnnnntcattaccaccatctcaacatttatgaacaaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
43996287 |
tcaactcataggaaaaattgcaattatcttcatcatcttgcaaaataaatcaataacgagaaaaaa--tcattaccaccatctcaacatttacgaacaaa |
43996190 |
T |
|
| Q |
101 |
accaacccattttcgtgaacctttggcggagggcggttgtagaatagtcttcctgggttcttttgtgaattgaccttttcgcataacacaccttttatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43996189 |
accaacccattttcgtgaacctttggcgaagggcggttgtagaatagtcttcttggattcttttgtgaattgaccttttcgcataacacaccttttatga |
43996090 |
T |
|
| Q |
201 |
caccgacaatcaaatatgatatactcaccatcaaacatggaggtttcagatgaagctcgacgccgagaactttctttaaacacatgaccaccatccgtta |
300 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43996089 |
caccaacaatcaaatatgatttactcaccatcaaacatggaggtttcagatgaagctcgacgttgagaactttctttaaacacatgaccaccatccatta |
43995990 |
T |
|
| Q |
301 |
ttttgctttgagcttgaacaacgtttatga |
330 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |
|
|
| T |
43995989 |
ttttgctttgagcttgaacaacttttatga |
43995960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University