View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_high_60 (Length: 254)
Name: NF12055_high_60
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_high_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 46231420 - 46231637
Alignment:
| Q |
18 |
aaagagtgtgtaccgatttt-ttatagacgagactctggatacaagtccttttcaagtagatggaaattggaatctcatttggcgcgccaaaagttaatc |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46231420 |
aaagagtgtgtaccgatttttttatagacgagactctggatacaagtccttttcaagtagatggaaattggaatctcatttggcgcgccaaaagttaatc |
46231519 |
T |
 |
| Q |
117 |
atttccgatgacgtatttgtagaaattgtttacctactcgaatccgactccaaaaccgtggagtgatcattgtcctaatagttgcgccctatgcgacgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
46231520 |
atttccgatgacgtatttgtagaaattgtttacctactcgaatccgactccaaaaccgtggagtgatcattgtcctaatagttgcgctctatgcgatgtt |
46231619 |
T |
 |
| Q |
217 |
ggtattgaggacgatgtg |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46231620 |
ggtattgaggacgatgtg |
46231637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University