View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_high_62 (Length: 248)
Name: NF12055_high_62
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_high_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 232
Target Start/End: Original strand, 39783473 - 39783696
Alignment:
| Q |
9 |
agcagagacatatgcaacttcaatatcagtaacggagacatcaaataccttgaactactaatacttatagaaagaataacgtggaggaatagatatagaa |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783473 |
agcaaagacatatgcaacttcaatatcagtaatggagacatcaaataccttgaactactaatacttatagaaagaataacgtggaggaatagatatagaa |
39783572 |
T |
 |
| Q |
109 |
gtacctgttgtttgaaagtttcttcatgctttaacatggccatcctcatgtattctttgtcacgtgacctaacaagcttctccatgaatgatcaatttag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39783573 |
gtacctgttgtttgaaagtttcttcatgctttaacatggccatcctcatgtattctttgtcacatgacctaacaagcttctccatcaatgatcaatttag |
39783672 |
T |
 |
| Q |
209 |
tttctatagaggctaactagtttt |
232 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39783673 |
tttctatagaggctaactagtttt |
39783696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University