View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12055_high_64 (Length: 246)

Name: NF12055_high_64
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12055_high_64
NF12055_high_64
[»] chr4 (1 HSPs)
chr4 (20-108)||(54088374-54088462)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 54088462 - 54088374
Alignment:
20 gaccctgcacgagatcctgcatgggagctggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga 108  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54088462 gaccctgcacgagatcctgcatgggagccggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga 54088374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University