View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_high_70 (Length: 239)
Name: NF12055_high_70
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_high_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 37581787 - 37581567
Alignment:
| Q |
3 |
aaaccacaatgtcatttagcgtgacacattagcacccctaacaaaattatttaacaaagagagcattttgaccgacatcattcaattgagggagtaatta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37581787 |
aaaccacaatgtcatttagcgtgacacattagcacccctaacaaaattatttaacaaagagagcattttaaccgacatcattcaattgagtgagtaatta |
37581688 |
T |
|
| Q |
103 |
actatttagtaaatttgggatccgaattgcccgacactcacaattaaggctctcagtttgttgaaaaaacaccagacagtcacgagtaattcaatttgat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37581687 |
actatttagtaaatttgggatccgaattgcccgacactcacaatttaggctctcagtttgttaaaaaaacaccagacagtcacgagtaattcaatttgat |
37581588 |
T |
|
| Q |
203 |
agctcggaaatgatgaattgt |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37581587 |
agctcggaaatgatgaattgt |
37581567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University