View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12055_high_73 (Length: 221)

Name: NF12055_high_73
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12055_high_73
NF12055_high_73
[»] chr4 (1 HSPs)
chr4 (1-221)||(26536455-26536675)


Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26536675 - 26536455
Alignment:
1 taaatcacgcttctcaacatcactttcttctttcaattcattaacctcacaaccaacactcaaaccattgttgcaaacagtcttttgtgtgtttgacttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26536675 taaatcacgcttctcaacatcactttcttctttcaattcattaacctcacaaccaacactcaaaccattgttgcaaacagtcttttgtgtgtttgacttg 26536576  T
101 taacttgtgtgcttccaatgagccatccatggtgatagataactataaccatgcattgcagcatccactctttcaccatcgcgatatgcacgagcagcaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
26536575 taacttgtgtgcttccaatgagccatccatggtgatagataactataaccatgcattgcagcatccactctttcaccatcgcgatatgcgcgagcagcaa 26536476  T
201 tctcatccggcatcatcactc 221  Q
    |||||||||||||||||||||    
26536475 tctcatccggcatcatcactc 26536455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University