View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_43 (Length: 309)
Name: NF12055_low_43
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 19 - 129
Target Start/End: Complemental strand, 45545650 - 45545540
Alignment:
| Q |
19 |
agcaactttcaaagatccctttgaaatgtaatacacctttcccatagcaaatttgtcataaaacttccttgcagcatcattaaacatagttgcttgaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545650 |
agcaactttcaaagatccctttgaaatgtaatacacctttcccatagcaaatttgtcataaaacttccttgcagcatcattaaacatagttgcttgaatc |
45545551 |
T |
|
| Q |
119 |
tgagtaccctg |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
45545550 |
tgagtaccctg |
45545540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 204 - 302
Target Start/End: Complemental strand, 45545457 - 45545359
Alignment:
| Q |
204 |
tcaaatatcctgttccttacatcttcatcggtcagttcaacattgaatacacaaccttctcctctagcattcttataggtacgcatagttcctttgctt |
302 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545457 |
tcaaatattctgttccttacatcttcatcagtcagttcaacattgaatacacaaccttctcctctagcattcttataggtacgcatagttcctttgctt |
45545359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University