View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_45 (Length: 296)
Name: NF12055_low_45
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 3624168 - 3623902
Alignment:
| Q |
1 |
atttcatagtctgttttctagtttgttgttttctgagcacannnnnnnggaggagattgtgtgacccaataaaagctctcaaatgttaagccacaccatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3624168 |
atttcatagtctgttttctagtttgttgttttctgagcacatttttttggaggagattgtgtgacccaataaaagctctcaaatgttaagccacaccatt |
3624069 |
T |
|
| Q |
101 |
tatctttttgacgaggtatagctgacaaggcaggtgatccaaaagaaatatctagaagtagtggggtccattattatcgattgtggtcgatacaaatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3624068 |
tatctttttgacgaggtatagctgacaaggcaggtgttccaaaagaaatatctagaagtagtggggtccattattatcgattgtggtcgatacagatggt |
3623969 |
T |
|
| Q |
201 |
tacgtcttctgctcactctactcacactagttgtgatttcggttctaatatggaattatgtcgttgataggttata |
276 |
Q |
| |
|
||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3623968 |
tacatcttgtg---------ctcacactagttgtgatttcggttctaatatggaattatgtcgttgataggttata |
3623902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University