View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_59 (Length: 257)
Name: NF12055_low_59
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 41325142 - 41325351
Alignment:
| Q |
18 |
cagttcaggctgctgatccacaggtttagccattgtgtatgtgccatgctgatcaatatttgaatctacaatattaatggtttcttgctccttcaactca |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325142 |
cagttcaggctgctgatccacaggcttagccattgtgtatgtgccatgctgatcaacatttgaatctacaatattaatggtttcttgctccttcaactca |
41325241 |
T |
|
| Q |
118 |
tctttagcatcttcatgatccaattgtaatttgaggccttcttccattctcttagcttcatccatgaatagaatagtgatgaatgatattcaacaatttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41325242 |
tctttagcatcttcatgatccaattgtaatttgaggccttcttccattctcttagcttcatccatgaatagaatagtgatgaatgatattcaacaaattt |
41325341 |
T |
|
| Q |
218 |
ttcaaacgta |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
41325342 |
ttcaaacgta |
41325351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University