View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_63 (Length: 248)
Name: NF12055_low_63
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_63 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 44 - 248
Target Start/End: Complemental strand, 9583447 - 9583243
Alignment:
| Q |
44 |
tgtgagggttaccatcgagaaggattgcaagtcactagttgatagcattgatggaagactacaagatgtgactgaaactctgcagtattctaaaattgca |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9583447 |
tgtgagggttaccatcgagaaggattgcaagtcactagttgatagcattgatggaagactataagatgtgactgaaactctacagtattctaaaattgca |
9583348 |
T |
|
| Q |
144 |
aaataattaatgaagaataaaaatcattcatcataaaactgtcatccaactcgaggatagcatttttaatgagtaaagattctcttcaattgacaacata |
243 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||| ||| ||| | ||||||||||| |
|
|
| T |
9583347 |
aaataattaatgaagaataaaaatcatccatcataaaactgtcatccaacttgaggatagcatttttaacgagtaaggatcatctctatttgacaacata |
9583248 |
T |
|
| Q |
244 |
aattt |
248 |
Q |
| |
|
||||| |
|
|
| T |
9583247 |
aattt |
9583243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University