View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_66 (Length: 246)
Name: NF12055_low_66
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 54088462 - 54088374
Alignment:
| Q |
20 |
gaccctgcacgagatcctgcatgggagctggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088462 |
gaccctgcacgagatcctgcatgggagccggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
54088374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University