View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_67 (Length: 245)
Name: NF12055_low_67
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 233
Target Start/End: Original strand, 8683051 - 8683269
Alignment:
| Q |
15 |
actcttggcattacagttctgattccaactataattgttcctcaaatgggtggaggagatgtgagaaatatttctgatcaatttgtatttgcttttaatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683051 |
actcttggcattacagttctgattccaactataattgttcctcaaatgggtggaggagatgtgagaaatatttctgatcaatttgtatttgcttttaatt |
8683150 |
T |
|
| Q |
115 |
ttaagcaacttttataatagtattaatgaacaaaatggtttgattcaatgtaggctgagaagactagggtgatacagacacttctatttgtgtctggact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683151 |
ttaagcaacttttataatagtattaatgaacaaaatggtttgattcaatgtaggctgagaagactagggtgatacagacacttctatttgtgtctggact |
8683250 |
T |
|
| Q |
215 |
aagcacattttttcgatct |
233 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
8683251 |
aagcacattttttcaatct |
8683269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 47579340 - 47579393
Alignment:
| Q |
15 |
actcttggcattacagttctgattccaactataattgttcctcaaatgggtgga |
68 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
47579340 |
actcttggcatgacagttttgattccaactatagttgttcctcaaatgggtgga |
47579393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University