View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12055_low_75 (Length: 221)
Name: NF12055_low_75
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12055_low_75 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26536675 - 26536455
Alignment:
| Q |
1 |
taaatcacgcttctcaacatcactttcttctttcaattcattaacctcacaaccaacactcaaaccattgttgcaaacagtcttttgtgtgtttgacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536675 |
taaatcacgcttctcaacatcactttcttctttcaattcattaacctcacaaccaacactcaaaccattgttgcaaacagtcttttgtgtgtttgacttg |
26536576 |
T |
 |
| Q |
101 |
taacttgtgtgcttccaatgagccatccatggtgatagataactataaccatgcattgcagcatccactctttcaccatcgcgatatgcacgagcagcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26536575 |
taacttgtgtgcttccaatgagccatccatggtgatagataactataaccatgcattgcagcatccactctttcaccatcgcgatatgcgcgagcagcaa |
26536476 |
T |
 |
| Q |
201 |
tctcatccggcatcatcactc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26536475 |
tctcatccggcatcatcactc |
26536455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University