View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12056_high_20 (Length: 244)
Name: NF12056_high_20
Description: NF12056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12056_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 18 - 127
Target Start/End: Original strand, 3871952 - 3872061
Alignment:
| Q |
18 |
atgtggatgtagtaaaatgtgtttggaattgatacatagagaatttagatctagttttctgggctcagataaacaggttcaataatgaatgatcaaggag |
117 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||| ||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
3871952 |
atgtggatgtcgtaaaatgggtttggaattgatacatagagaatttagatctagctttccgggcttagatgaacaagttcaataatgaatgatcaaggag |
3872051 |
T |
|
| Q |
118 |
aaagaacatg |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
3872052 |
aaagaacatg |
3872061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University