View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12056_high_23 (Length: 238)
Name: NF12056_high_23
Description: NF12056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12056_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 46838453 - 46838673
Alignment:
| Q |
4 |
cttttgttgttcgtttacattttggttacttgagttggaccatgtagtccggtgtaatgtttttatctccataaatttgtgaggttatctatcaatagtg |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46838453 |
cttttgttgttcatttacattttggttacttgagttggatcatgtagtccggtgtaatgcttttatctccataaatttgtgaggttatctatcaatagtg |
46838552 |
T |
|
| Q |
104 |
taacttagagacggatctactctaaagatattggggagagctgaccccacaacttcaatctcttgttaaccaatattatgacattttgatgttataagcc |
203 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46838553 |
taacttagagatggatctactctatagatattgaggagagctgaccccacaacttcaatctcttgttaaccaatattatgatattttgatgttataagcc |
46838652 |
T |
|
| Q |
204 |
ccagctcaaatagtgttatgt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46838653 |
ccagctcaaatagtgttatgt |
46838673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University