View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12056_high_26 (Length: 222)
Name: NF12056_high_26
Description: NF12056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12056_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 52581113 - 52580928
Alignment:
| Q |
17 |
agatgaaatactggttggcagcgtcttcattaagcattctttacgaaaaacggttacagtatatatt-gtaaaacagcttctccttagaaaaaatccggc |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52581113 |
agatgaaatactggttggcagcgtgttcattaagcattctttacgaaaaacggttacagtatatatttgtaaaacaacttctccttagaaaaaatccggc |
52581014 |
T |
|
| Q |
116 |
taggataatccatcttttttgcccaactgaatgaaattactaattagtcatggttaaacgacaatgaatgatttgtacttgtaacaagttttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52581013 |
taggataatccatcttttttgcccaactgaatgaa-------attagtcatggttaaacgacaatgaatgatttgtacttgtaacaagttttt |
52580928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University