View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12056_high_5 (Length: 457)
Name: NF12056_high_5
Description: NF12056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12056_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 177 - 445
Target Start/End: Original strand, 25494062 - 25494330
Alignment:
| Q |
177 |
atggtgtatttaatgttgggttcaatgaagtggttattgaacttcagttaaggacaaactactcgagagaatttgagtttgatttttggctgagcaaact |
276 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||| |||||||||||||| ||||||||||||| |||||||||||| |||||| | |||||||| |
|
|
| T |
25494062 |
atggtgtatttaatattgggttcaa----gtgattattgaccttcagttaaggacgaactactcgagaggatttgagtttgaattttggttaagcaaact |
25494157 |
T |
|
| Q |
277 |
ttatttatctctgatcaaacgccagattac----gtctcttttctttaaaattaaaagattaagacaaaaaatgacaatttttgggaattctaacatttt |
372 |
Q |
| |
|
|||||| | || ||||||| | ||||| ||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25494158 |
ttatttgtgtccgatcaaatttcggattatcagagtctcttttctctaaaactaaaggattaagacaaaaaatgacaatttttgggaattctaacatttt |
25494257 |
T |
|
| Q |
373 |
ttgttgtgaatattcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatct |
445 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25494258 |
ttgttatgaatattcaggttcagtgtagattttggcaagaatgaggtagaagttatgaagcatgtgtcaatct |
25494330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 386 - 445
Target Start/End: Complemental strand, 28225970 - 28225911
Alignment:
| Q |
386 |
tcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatct |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28225970 |
tcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatct |
28225911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University