View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12056_low_17 (Length: 316)
Name: NF12056_low_17
Description: NF12056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12056_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 20 - 309
Target Start/End: Complemental strand, 46039462 - 46039162
Alignment:
| Q |
20 |
aattttgtgaccgatgtttagatgaaaagctactt----------ccactgtttatgatttagatgaaaatttctaaactctttagtgaattttataatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46039462 |
aattttgtgaccgatgtttagatgaaaagctacttatactaatttccactgtttatgatttagatgaaaatttctaaactctttagtgaattttataatg |
46039363 |
T |
|
| Q |
110 |
aagtttagctgtaaatctaagctgtaaaa-ttcacactttgtcttttgcacaattgatctcgcgacaaaataacttattttttcctagactgtattatga |
208 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46039362 |
aagtttagctgttacactaagctgtaaaaattcacactttgtcttttgcacaattgatctcgcgacaaaataacttattttttcctagactgtattatga |
46039263 |
T |
|
| Q |
209 |
aagcaacacaactcatgatacttcatgcatgcgtctagctcatccatgtgatgcccccatctaccgtccgcagtctacagctaagttgaggtggctcatt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46039262 |
aagcaacacaactcatgatacttcatgcatgcgtctagctcatccatgtgatgcccccatctaccgtccgcagtctacagctaagttgaggtggctcatt |
46039163 |
T |
|
| Q |
309 |
g |
309 |
Q |
| |
|
| |
|
|
| T |
46039162 |
g |
46039162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University