View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12056_low_23 (Length: 239)

Name: NF12056_low_23
Description: NF12056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12056_low_23
NF12056_low_23
[»] chr4 (1 HSPs)
chr4 (1-216)||(4676907-4677122)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 4676907 - 4677122
Alignment:
1 aacgtaatttgaccaatataaatgacaaataattgatattcattgttcaaatgttcaatacacattgcagtttggacactgcagaaacaaataaatttga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4676907 aacgtaatttgaccaatataaatgacaaataattgatattcattgttcaaatgttcaatacacattgcagtttggacactgcagaaacaaataaatttga 4677006  T
101 cacaggtatagctataatgatcgataatcaatggattaaaaaacaaatgaaatgctgtaatgaatattttgtaacacttttaaaggcaaatgcaattata 200  Q
    ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4677007 cacgggtatagctataatgatcgataatcaatggattaacaaacaaatgaaatgctgtaatgaatattttgtaacacttttaaaggcaaatgcaattata 4677106  T
201 aagtagatagataact 216  Q
    ||||||||||||||||    
4677107 aagtagatagataact 4677122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University