View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12057_low_24 (Length: 231)
Name: NF12057_low_24
Description: NF12057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12057_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 7 - 195
Target Start/End: Complemental strand, 8587491 - 8587308
Alignment:
| Q |
7 |
agttgaattctctttcgaaa-ggttaaggtttcgttttcatgttctgtttgttaaatagcataaaggggtggaggtggactttatatgaaannnnnnngt |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
8587491 |
agttgaattctctttcgaaaaggttaaggtttcgttttcatgttctgtttgttaaatagcataaaggggtgga------ctttatatgaaatttttttat |
8587398 |
T |
|
| Q |
106 |
atgaaaattaagttcatccgtagttttaggagatggtaagttgattttaaaattacccttttctcttctatgtaaaaggctaaaattatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8587397 |
atgaaaattaagttcatccgtagttttaggagatattaagttgattttaaaattaccattttgtcttctatgtaaaaggctaaaattatg |
8587308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Complemental strand, 8587278 - 8587248
Alignment:
| Q |
201 |
tttatgtttcgatacactgtaaaagtgggtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8587278 |
tttatgtttcgatacactgtaaaagtgggtt |
8587248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University