View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12061_low_9 (Length: 241)
Name: NF12061_low_9
Description: NF12061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12061_low_9 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 28927508 - 28927584
Alignment:
| Q |
165 |
aagtaaataaatatcaaagttagttcattttaatttttgattatgttttgctttcaatcatttcaatgtgtttttct |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
28927508 |
aagtaaataaatatcaaatttagttcattttaatttttgaatgtgttttgctttcaatcatttcaatgtgtttttct |
28927584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 28926670 - 28926734
Alignment:
| Q |
19 |
taagttatgtggtgcaatcatggagggactcttcaaccaaccaaactatgtgtagttacactaat |
83 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28926670 |
taagttatgtggtgcaatcacggagggactgttcaaccaaccaaactatgtgtagttacactaat |
28926734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 30112778 - 30112702
Alignment:
| Q |
165 |
aagtaaataaatatcaaagttagttcattttaatttttgattatgttttgctttcaatcatttcaatgtgtttttct |
241 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||||| | | |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
30112778 |
aagtaaacaaatatcaaatttagttcattttgatttttcaatgtgttttgctttcaatcattttaatttgtttttct |
30112702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 30112937 - 30112880
Alignment:
| Q |
26 |
tgtggtgcaatcatggagggactcttcaaccaaccaaactatgtgtagttacactaat |
83 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30112937 |
tgtggtgcaatcccgaagggactcttcaaccaaccaaagtatgtgtagttacactaat |
30112880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University