View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12062_low_13 (Length: 239)
Name: NF12062_low_13
Description: NF12062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12062_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 34924922 - 34925122
Alignment:
| Q |
1 |
atgtgaagcttaagatgtgtgacataaacaatttattcttcttaacgaaattccacttatcttgcaactataaataaatctgaagctctcatattctgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
34924922 |
atgtgaagcttaagatgtgtgacataaacaatttattcttcttaacgaaattccacttatcttgcaactataaataaatctcaagctctcatcttctgat |
34925021 |
T |
 |
| Q |
101 |
atactttcggataatacacttggagataaagcaaagcacaagcaacaagatgaagaagtaatctaggagtaggatcttgattcttgaatgttcttttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34925022 |
atactttcggataatacacttggagataaagcaaagcacaagcaacaagatgaagaagtaatctaggagtaggatcttgatttttgaatgttcttttcat |
34925121 |
T |
 |
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
34925122 |
c |
34925122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University