View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12063_high_13 (Length: 333)
Name: NF12063_high_13
Description: NF12063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12063_high_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 13 - 333
Target Start/End: Original strand, 8930887 - 8931207
Alignment:
| Q |
13 |
gaacctgtggcaaatatgtgaatgagtttattacgaataaactaacagataaaatttaaagtttactagtttaaaagtgaatagttgaaccaattatatt |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8930887 |
gaacctgtgacaaatatgtgaatgagtttattacgattaaactaacagataaaatttaaagtttactagtttaaaagtaaatagttgaaccaattatatt |
8930986 |
T |
 |
| Q |
113 |
gcaacccaccaaagggcaagctgttagtttctataggagggtctgtacaccccatggcaagattctaaacccatcctcgcagggacgtgtcttaggccca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8930987 |
gcaacccaccaaagggcaagctgttagtttctataggagggtctgtacaccccatggcaagattctaaacccttcctcgcagggacgtgtcttaggccca |
8931086 |
T |
 |
| Q |
213 |
accgtttgttatagctagggggcgactagggtgagggaggcgatagccctcgcagtacggtttagtggttttattgtaatctgaatcgtagtaactagta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931087 |
accgtttgttatagctagggggcgactagggtgagggaggcgatagccctcgcagtacggttcagtggttttattgtaatctgaatcgtagtaactagta |
8931186 |
T |
 |
| Q |
313 |
atatatattgcttgtaaaact |
333 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8931187 |
atatatattgcttgtaaaact |
8931207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University