View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12065_low_17 (Length: 230)
Name: NF12065_low_17
Description: NF12065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12065_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 14 - 124
Target Start/End: Complemental strand, 7377664 - 7377554
Alignment:
| Q |
14 |
caaaggttagtaaaatgacaaagttcacctcccaaatcactttgaacatctttaatattgattaaaaatttagtgtgaatgaacttaaaaatttgttgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7377664 |
caaaggttagtaaaatgacaaagttcacctcccaaatcactttgaacatctttaatattgattaaaaatttagtgtgaatgaacttaaaaatttgttgga |
7377565 |
T |
|
| Q |
114 |
gtgcttgaaag |
124 |
Q |
| |
|
||||||||||| |
|
|
| T |
7377564 |
gtgcttgaaag |
7377554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 194
Target Start/End: Complemental strand, 7377456 - 7377397
Alignment:
| Q |
134 |
caatggtgatgagcatgaataactttgagagcttcgaatatgctgaaacaaatagtaaagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
7377456 |
caatggtgatgagcatgaataactttaagagcttcaaatatg-tgaaacaaatagtaaagc |
7377397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University