View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12066_high_3 (Length: 438)
Name: NF12066_high_3
Description: NF12066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12066_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 239 - 433
Target Start/End: Original strand, 18608001 - 18608195
Alignment:
| Q |
239 |
gtagaatgcaatgatatggacttatgatgcacaaaatattaattagatggtataatacaagtattttggttggactgtttggtataatactatcttttct |
338 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18608001 |
gtagaatgaaatgatatggacttatggtgcacaaaatattaattagatggtataatgcaagtattttggttggactgtttggtataatactatcttttct |
18608100 |
T |
|
| Q |
339 |
ggtctaatttgtctcattgcctctaagttttggattgtttaattttctttgacttttgttgtattccacttcttccagctcttgcctttgcttct |
433 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
18608101 |
ggtctagtttgtctcattgcctctaagttttggattgtttaattttctttgacttttgttgtattccacttcttgcagctcttgcttttgtttct |
18608195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 14 - 163
Target Start/End: Original strand, 18607776 - 18607925
Alignment:
| Q |
14 |
caaaacctcctttacaaaagagatggcatataaagtgggaaaaacatcaacaattcagtctctaagcaatggtcattcnnnnnnnnttaataatattttg |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18607776 |
caaaacttcctttacaaaagagatggcatataaactgggaaaaacatcaacaattcagtctctaagcaatggtcattcaaaaaaatttaataatattttg |
18607875 |
T |
|
| Q |
114 |
tcctattatatgtgtagcgtttgcttaatcatgtcaagcaaattatagag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18607876 |
tcctattatatgtgtagcgtttgcttaatcatgtcaagcaaattatagag |
18607925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University