View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12066_high_7 (Length: 224)
Name: NF12066_high_7
Description: NF12066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12066_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 125 - 217
Target Start/End: Complemental strand, 40210537 - 40210445
Alignment:
| Q |
125 |
tgtatggtgatagtaggttaatatagatgattataatcagaaataagtctttttactttagaagttaatttcatgaggttgagctaaagttta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40210537 |
tgtatggtgatagtaggttaatatagatgattataatcagcaataagtctttttactttagaagttaatttcatgaggttgagctaaaattta |
40210445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 2 - 45
Target Start/End: Complemental strand, 40210660 - 40210617
Alignment:
| Q |
2 |
tctccacccattcaaatacttattttgttttttgttacacaata |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40210660 |
tctccacccattcaaatacttattttgttttttgttacacaata |
40210617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University