View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12066_high_8 (Length: 222)

Name: NF12066_high_8
Description: NF12066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12066_high_8
NF12066_high_8
[»] chr1 (1 HSPs)
chr1 (14-207)||(27632161-27632354)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 207
Target Start/End: Complemental strand, 27632354 - 27632161
Alignment:
14 caaaggaaagctctatagacagttgtcccttatcagattggggaatgagaaactcaccttatcatgaaagtagaatatcagattggatagaagaattgca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27632354 caaaggaaagctctatagacagttgtcccttatcagattggggaatgagaaactcaccttatcatgaaagtagaatatcagattggatagaagaattgca 27632255  T
114 aaatggatttggtgataaggaaaaggaattaggacaagattttaatagtataaatggatcaatatatgattataatccccagcaagaatatgat 207  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27632254 aaatggatttggtgataaggaaatggaattaggacaagaatttaatagtataaatggatcaatatatgattataatccccagcaagaatatgat 27632161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University