View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12067_high_17 (Length: 242)
Name: NF12067_high_17
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12067_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 2974609 - 2974500
Alignment:
| Q |
17 |
agtatataatatgaaaccctttgattttccaaactccacaagtatatatttgatttttgatagagtaccttttgcacttcattatagttttagttataag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2974609 |
agtatataatatgaaaccctttgattttccaaactccacaagtatatatttgatttttgatagagtaccttttgcacttcattatagttatagttataag |
2974510 |
T |
 |
| Q |
117 |
accatatatc |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
2974509 |
accatatatc |
2974500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University