View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12067_low_11 (Length: 365)
Name: NF12067_low_11
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12067_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 198 - 352
Target Start/End: Complemental strand, 42656634 - 42656479
Alignment:
| Q |
198 |
gtatttttaggaaattgnnnnnnnacataatccactgtaaataaaattgacaactgta-tttgtacgtactgcttgttttgaagctgacaacttataata |
296 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
42656634 |
gtatttttaggaaattgtttttttacataatccactgtaaataaaattgacaactgtaatttgtacgtaccgcttgttttgaagctgacaacttatcata |
42656535 |
T |
 |
| Q |
297 |
tagagacaaaaatgataaaagacaaagtacatagtaataaattagatcacctatct |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42656534 |
tagagacaaaaatgataaaagacaaagtacatagtaataaattagatcacctatct |
42656479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 94 - 141
Target Start/End: Complemental strand, 42656829 - 42656782
Alignment:
| Q |
94 |
caacagtgtataaccaaaaataataattccatagtatgattattgttt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42656829 |
caacagtgtataaccaaaaataataattcaatagtatgattattgttt |
42656782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University