View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12067_low_16 (Length: 291)

Name: NF12067_low_16
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12067_low_16
NF12067_low_16
[»] chr3 (3 HSPs)
chr3 (8-194)||(33624949-33625136)
chr3 (37-83)||(33628610-33628656)
chr3 (145-194)||(1744783-1744832)


Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 8 - 194
Target Start/End: Original strand, 33624949 - 33625136
Alignment:
8 acaaattggtatcaaagagcattggttcgattcaagctttc-gtcaatggcaaatggaagcacaacctcaaaccaattccc-tgcaaatctgctagtttt 105  Q
    |||||||| |||| ||||| || ||||||||| |||||||  ||| || || ||||||||  ||||||||||||||| ||| || |||||||  ||||||    
33624949 acaaattgctatctaagagtat-ggttcgatttaagctttatgtcgatagcgaatggaagatcaacctcaaaccaatccccatgtaaatctgtaagtttt 33625047  T
106 caaagaagaacactatgacagatggtgcgcacatatgagagtcatattcacgtttcaagatgttcttgagatcgtgaatgatggcatac 194  Q
     |||| |||||| ||||| ||||||||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||||    
33625048 taaaggagaacattatgagagatggtgcgcacatatgagagtcatattcaagcttcaagattttcttgagatcgtaaatgatggcatac 33625136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 37 - 83
Target Start/End: Original strand, 33628610 - 33628656
Alignment:
37 attcaagctttcgtcaatggcaaatggaagcacaacctcaaaccaat 83  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
33628610 attcaagctttcgtcaatggcaaatggaagcacaacctcaaaccaat 33628656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 194
Target Start/End: Complemental strand, 1744832 - 1744783
Alignment:
145 agtcatattcacgtttcaagatgttcttgagatcgtgaatgatggcatac 194  Q
    ||||||||| |  ||||||||||||| ||| |||||||||||||||||||    
1744832 agtcatatttagatttcaagatgttcctgaaatcgtgaatgatggcatac 1744783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University