View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12067_low_16 (Length: 291)
Name: NF12067_low_16
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12067_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 8 - 194
Target Start/End: Original strand, 33624949 - 33625136
Alignment:
| Q |
8 |
acaaattggtatcaaagagcattggttcgattcaagctttc-gtcaatggcaaatggaagcacaacctcaaaccaattccc-tgcaaatctgctagtttt |
105 |
Q |
| |
|
|||||||| |||| ||||| || ||||||||| ||||||| ||| || || |||||||| ||||||||||||||| ||| || ||||||| |||||| |
|
|
| T |
33624949 |
acaaattgctatctaagagtat-ggttcgatttaagctttatgtcgatagcgaatggaagatcaacctcaaaccaatccccatgtaaatctgtaagtttt |
33625047 |
T |
|
| Q |
106 |
caaagaagaacactatgacagatggtgcgcacatatgagagtcatattcacgtttcaagatgttcttgagatcgtgaatgatggcatac |
194 |
Q |
| |
|
|||| |||||| ||||| ||||||||||||||||||||||||||||||| | |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
33625048 |
taaaggagaacattatgagagatggtgcgcacatatgagagtcatattcaagcttcaagattttcttgagatcgtaaatgatggcatac |
33625136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 37 - 83
Target Start/End: Original strand, 33628610 - 33628656
Alignment:
| Q |
37 |
attcaagctttcgtcaatggcaaatggaagcacaacctcaaaccaat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33628610 |
attcaagctttcgtcaatggcaaatggaagcacaacctcaaaccaat |
33628656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 194
Target Start/End: Complemental strand, 1744832 - 1744783
Alignment:
| Q |
145 |
agtcatattcacgtttcaagatgttcttgagatcgtgaatgatggcatac |
194 |
Q |
| |
|
||||||||| | ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1744832 |
agtcatatttagatttcaagatgttcctgaaatcgtgaatgatggcatac |
1744783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University