View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12067_low_17 (Length: 242)

Name: NF12067_low_17
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12067_low_17
NF12067_low_17
[»] chr3 (1 HSPs)
chr3 (17-126)||(2974500-2974609)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 2974609 - 2974500
Alignment:
17 agtatataatatgaaaccctttgattttccaaactccacaagtatatatttgatttttgatagagtaccttttgcacttcattatagttttagttataag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
2974609 agtatataatatgaaaccctttgattttccaaactccacaagtatatatttgatttttgatagagtaccttttgcacttcattatagttatagttataag 2974510  T
117 accatatatc 126  Q
    ||||||||||    
2974509 accatatatc 2974500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University