View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12067_low_19 (Length: 239)
Name: NF12067_low_19
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12067_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 31442370 - 31442159
Alignment:
| Q |
1 |
ccttcacttttagtataagagatttttctccctccactttcttcaaataattaaaccaaacaactcaaatacgaaataagaattcacctctcttccactt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31442370 |
ccttcacttttagcataagagatttttctccctccactttcttcaaataattaaaccaaacaactcaaatacgaaataagaattcacctctcttccactt |
31442271 |
T |
|
| Q |
101 |
cctttctacctaaaataacttactaacaaccaatctttattgatgttattttgataccgaggaaagttgaactcatgatctcctcaatagataattccaa |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31442270 |
cctttctacctaaaataatttactaacaaccaatgttta-----------ttgataccgaggaaagttgaactcatgatttcctcaatagataattccaa |
31442182 |
T |
|
| Q |
201 |
cccttgtgtcgctgacctcaaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31442181 |
cccttgtgtcgctgacctcaaat |
31442159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University