View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12067_low_4 (Length: 504)
Name: NF12067_low_4
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12067_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 1e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 362 - 482
Target Start/End: Original strand, 46347086 - 46347205
Alignment:
| Q |
362 |
atgtttgacttatattttttagataannnnnnnnatgggtttcttaaacaatgtctttaatacacttgttaatatagccaaataaatattagtattattt |
461 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46347086 |
atgtttgacttatattttttagataattttttt-atgggtttcttaaacaatgtctttaagacacttgttaatatagccaaataaatattagtactattt |
46347184 |
T |
 |
| Q |
462 |
tttattatgtcacgatctaag |
482 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46347185 |
tttattatgtcacgatctaag |
46347205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University