View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12067_low_4 (Length: 504)

Name: NF12067_low_4
Description: NF12067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12067_low_4
NF12067_low_4
[»] chr7 (1 HSPs)
chr7 (362-482)||(46347086-46347205)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 1e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 362 - 482
Target Start/End: Original strand, 46347086 - 46347205
Alignment:
362 atgtttgacttatattttttagataannnnnnnnatgggtttcttaaacaatgtctttaatacacttgttaatatagccaaataaatattagtattattt 461  Q
    ||||||||||||||||||||||||||        |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||    
46347086 atgtttgacttatattttttagataattttttt-atgggtttcttaaacaatgtctttaagacacttgttaatatagccaaataaatattagtactattt 46347184  T
462 tttattatgtcacgatctaag 482  Q
    |||||||||||||||||||||    
46347185 tttattatgtcacgatctaag 46347205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University