View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12068_high_11 (Length: 238)
Name: NF12068_high_11
Description: NF12068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12068_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 52853601 - 52853759
Alignment:
| Q |
1 |
ccaacttcaaatcaaatcaaaaattacatgatccatttcataatagatagggaaggaagttcaagcatttccttcatgaatcagtaggagtatatattgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853601 |
ccaacttcaaatcaaatcaaaaattacatgatccatttcataatagatagggaa----gttcaagcatttccttcatgaatcagtaggagtatatattgt |
52853696 |
T |
 |
| Q |
101 |
ccgtttgtcaatgcttgaacaagatgccctgaactgtccctagagcacattctatcccatggc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853697 |
ccgtttgtcaatgcttgaacaagatgccctgaactgtccctagagcacattctatcccatggc |
52853759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 58 - 179
Target Start/End: Original strand, 48490932 - 48491053
Alignment:
| Q |
58 |
agttcaagcatttccttcatgaatcagtaggagtatatattgtccgtttgtcaatgcttgaacaagatgccctgaactgtccctagagcacattctatcc |
157 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | | ||| |||||||||||||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
48490932 |
agttcaagcatttccttcatgaaccagtaggagtgtctgatgtgagtttgtcaatgcttgaacaagatgccctgaaccgtccctggagcaccttctatcc |
48491031 |
T |
 |
| Q |
158 |
catggcaaggattatcaaactt |
179 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
48491032 |
catggcaagggttatcaaactt |
48491053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 48483489 - 48483533
Alignment:
| Q |
179 |
tccattaaattacatcttcccaggctaaatgactcatggagaata |
223 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
48483489 |
tccattaaattacatcttccgagactaaatgactcgtggagaata |
48483533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University